ID: 1197132325_1197132328 |
View in Genome Browser |
Spacer: -9 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1197132325 | 1197132328 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | X:123019730-123019752 | X:123019744-123019766 |
| Sequence | CCAGAGGAGCAGGGGGTAAAACT | GGTAAAACTCCACAGGGAAAAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 3, 1: 69, 2: 87, 3: 83, 4: 373} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||