ID: 1197405521_1197405527

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1197405521 1197405527
Species Human (GRCh38) Human (GRCh38)
Location X:126043336-126043358 X:126043371-126043393
Sequence CCTCGAATGCATGCAATGAAAGC AAAGAGACTCTTCTTTTTGTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!