ID: 1197499741_1197499749

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1197499741 1197499749
Species Human (GRCh38) Human (GRCh38)
Location X:127228934-127228956 X:127228966-127228988
Sequence CCGTGTCCCATCTGTGTGGGACC ATCGGACTGTCCAACTCACCTGG
Strand - +
Off-target summary No data {0: 50, 1: 365, 2: 316, 3: 98, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!