ID: 1198175713_1198175718

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1198175713 1198175718
Species Human (GRCh38) Human (GRCh38)
Location X:134152464-134152486 X:134152503-134152525
Sequence CCAGCGTGAACCCACTTGCCCAA GACCCCTCCTTTACTTGCACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!