ID: 1198177585_1198177596

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1198177585 1198177596
Species Human (GRCh38) Human (GRCh38)
Location X:134172073-134172095 X:134172107-134172129
Sequence CCGTCCCCTCCCACCCAACCAGT GATCACAGCTGCCCCAACGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!