ID: 1198177590_1198177596

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1198177590 1198177596
Species Human (GRCh38) Human (GRCh38)
Location X:134172083-134172105 X:134172107-134172129
Sequence CCACCCAACCAGTCAACTCTACC GATCACAGCTGCCCCAACGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 139} {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!