ID: 1198177608_1198177624

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1198177608 1198177624
Species Human (GRCh38) Human (GRCh38)
Location X:134172150-134172172 X:134172191-134172213
Sequence CCCGCTCGGGAAACCGCGCGCGG CCCTCGCAGGTGGAGAGCGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!