ID: 1198274884_1198274889

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1198274884 1198274889
Species Human (GRCh38) Human (GRCh38)
Location X:135090828-135090850 X:135090847-135090869
Sequence CCCCAGGGTTAGAGCCAGGAGCC AGCCCAGACTAAAGGCAGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 243} {0: 1, 1: 0, 2: 2, 3: 22, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!