ID: 1198556627_1198556633

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1198556627 1198556633
Species Human (GRCh38) Human (GRCh38)
Location X:137800022-137800044 X:137800066-137800088
Sequence CCTCCATCTCCAGACATTGCAAA TCACCCTGACTGAGAACCACTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 4, 3: 45, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!