ID: 1198556627_1198556633 |
View in Genome Browser |
Spacer: 21 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1198556627 | 1198556633 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | X:137800022-137800044 | X:137800066-137800088 |
| Sequence | CCTCCATCTCCAGACATTGCAAA | TCACCCTGACTGAGAACCACTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 2, 2: 4, 3: 45, 4: 236} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||