ID: 1198565275_1198565282

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1198565275 1198565282
Species Human (GRCh38) Human (GRCh38)
Location X:137897611-137897633 X:137897631-137897653
Sequence CCAGGAGAGGTAAGAAAGGGCAC CACAGCAGGGGGGTGGCACATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 26, 4: 333}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!