ID: 1198942401_1198942405

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1198942401 1198942405
Species Human (GRCh38) Human (GRCh38)
Location X:141971010-141971032 X:141971026-141971048
Sequence CCCATCCCTAGAAGGCTTTAAAA TTTAAAAATATTTTTCATTATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 47, 3: 334, 4: 2437}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!