ID: 1198942402_1198942405 |
View in Genome Browser |
Spacer: -8 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1198942402 | 1198942405 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | X:141971011-141971033 | X:141971026-141971048 |
Sequence | CCATCCCTAGAAGGCTTTAAAAA | TTTAAAAATATTTTTCATTATGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 1, 2: 47, 3: 334, 4: 2437} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |