ID: 1199607486_1199607491

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1199607486 1199607491
Species Human (GRCh38) Human (GRCh38)
Location X:149587446-149587468 X:149587470-149587492
Sequence CCCCCAGTGCGCACGTCAGTGAC TCACATCCGGCCCCCAAGCCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 21, 4: 64} {0: 2, 1: 4, 2: 1, 3: 7, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!