ID: 1199607486_1199607502

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1199607486 1199607502
Species Human (GRCh38) Human (GRCh38)
Location X:149587446-149587468 X:149587495-149587517
Sequence CCCCCAGTGCGCACGTCAGTGAC CTTCCCTGGGTTGCCAGTAGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 21, 4: 64} {0: 2, 1: 0, 2: 2, 3: 25, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!