ID: 1199631012_1199631015

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1199631012 1199631015
Species Human (GRCh38) Human (GRCh38)
Location X:149776600-149776622 X:149776613-149776635
Sequence CCTTTTGCCATCTCTGGGTACCG CTGGGTACCGGTGACCCTAGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 116} {0: 2, 1: 0, 2: 0, 3: 2, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!