ID: 1199864112_1199864121

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1199864112 1199864121
Species Human (GRCh38) Human (GRCh38)
Location X:151827639-151827661 X:151827670-151827692
Sequence CCTTCCTTCCAGGCCCACAGCAC CCTCTTCCCATAGGACTCTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 19, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!