ID: 1200053915_1200053941

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1200053915 1200053941
Species Human (GRCh38) Human (GRCh38)
Location X:153448853-153448875 X:153448899-153448921
Sequence CCCCCGCCCACCTGCCCCCTGCC TGGCACACAGTGAGGAGGCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!