ID: 1200053931_1200053942

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1200053931 1200053942
Species Human (GRCh38) Human (GRCh38)
Location X:153448876-153448898 X:153448900-153448922
Sequence CCCCAAGCCCCAGGGGCAGCACA GGCACACAGTGAGGAGGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 36, 4: 383} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!