ID: 1200128735_1200128753

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1200128735 1200128753
Species Human (GRCh38) Human (GRCh38)
Location X:153830135-153830157 X:153830180-153830202
Sequence CCTCGAGCCCTCCCGCTCTCCCA CACTGGCCCGCTCCTCCCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 409} {0: 1, 1: 0, 2: 1, 3: 15, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!