ID: 1200128743_1200128754

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1200128743 1200128754
Species Human (GRCh38) Human (GRCh38)
Location X:153830155-153830177 X:153830183-153830205
Sequence CCACGCCCGCCGCTCCGGGCCTC TGGCCCGCTCCTCCCCGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 70, 4: 535} {0: 1, 1: 0, 2: 1, 3: 9, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!