ID: 1200128743_1200128763

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1200128743 1200128763
Species Human (GRCh38) Human (GRCh38)
Location X:153830155-153830177 X:153830207-153830229
Sequence CCACGCCCGCCGCTCCGGGCCTC CCGCGCCCCCGCCGCAGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 70, 4: 535} {0: 1, 1: 0, 2: 7, 3: 83, 4: 459}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!