ID: 1200187967_1200187974

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1200187967 1200187974
Species Human (GRCh38) Human (GRCh38)
Location X:154195350-154195372 X:154195368-154195390
Sequence CCACTGCCCCTTAGCTGTCACTG CACTGTGGATGAGTGTCATGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!