ID: 1200193610_1200193624

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1200193610 1200193624
Species Human (GRCh38) Human (GRCh38)
Location X:154232455-154232477 X:154232508-154232530
Sequence CCGAGCCGCTCACCAGACAGTCT CACTGTGGATGAGTGTCATGGGG
Strand - +
Off-target summary No data {0: 4, 1: 0, 2: 0, 3: 19, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!