ID: 1200440709_1200440712

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1200440709 1200440712
Species Human (GRCh38) Human (GRCh38)
Location Y:3208834-3208856 Y:3208858-3208880
Sequence CCAATTATAGATTATGAAACTAG GAATTAAGCACAGAATGATTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!