ID: 1200746055_1200746061

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1200746055 1200746061
Species Human (GRCh38) Human (GRCh38)
Location Y:6904859-6904881 Y:6904904-6904926
Sequence CCAAAGCCCAGTAATAAGCCAAG AGTTACCCACAGAAGATGGCAGG
Strand - +
Off-target summary {0: 2, 1: 23, 2: 206, 3: 192, 4: 364} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!