|
Left Crispr |
Right Crispr |
| Crispr ID |
1200973122 |
1200973127 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
Y:9177703-9177725
|
Y:9177742-9177764
|
| Sequence |
CCCAGTAATGGGCCAAGAGCTGT |
ATTTATCTACAGAAGATGGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 27, 2: 194, 3: 220, 4: 255} |
{0: 1, 1: 11, 2: 210, 3: 207, 4: 286} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|