|
Left Crispr |
Right Crispr |
| Crispr ID |
1200998278 |
1200998282 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
Y:9400445-9400467
|
Y:9400474-9400496
|
| Sequence |
CCTTGAGAGGAAGACAGAGAGTG |
TCCAGGACGTTCATGGCATTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 5, 2: 4, 3: 50, 4: 427} |
{0: 9, 1: 1, 2: 3, 3: 6, 4: 69} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|