ID: 1201349671_1201349674

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1201349671 1201349674
Species Human (GRCh38) Human (GRCh38)
Location Y:13025857-13025879 Y:13025875-13025897
Sequence CCTCTGGAACTCCAGAGTGTCTA GTCTATGTTGGTCTGCCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 236} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!