ID: 1201419459_1201419464

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1201419459 1201419464
Species Human (GRCh38) Human (GRCh38)
Location Y:13782468-13782490 Y:13782495-13782517
Sequence CCACCCAGTTTGAACTTCCTTGC TTGTTTACCTACTCAAGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 23, 2: 460, 3: 1826, 4: 3202} {0: 408, 1: 745, 2: 2190, 3: 577, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!