ID: 1201491822_1201491830

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1201491822 1201491830
Species Human (GRCh38) Human (GRCh38)
Location Y:14549922-14549944 Y:14549948-14549970
Sequence CCTGGGACCTTCACCCCATCTGC TAATGAGCTTCCTGCCTGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 23, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!