ID: 1201798423_1201798428

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1201798423 1201798428
Species Human (GRCh38) Human (GRCh38)
Location Y:17926667-17926689 Y:17926705-17926727
Sequence CCTGCCATCTTCTGCAGATAACC GACAGCTCTTGGCCTGTTACTGG
Strand - +
Off-target summary {0: 10, 1: 193, 2: 189, 3: 116, 4: 206} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!