ID: 1201803122_1201803130

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1201803122 1201803130
Species Human (GRCh38) Human (GRCh38)
Location Y:17979243-17979265 Y:17979290-17979312
Sequence CCACCAAACCCAGTAACAGGCCA GGTTATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary No data {0: 10, 1: 193, 2: 189, 3: 116, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!