ID: 1202276537_1202276540

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1202276537 1202276540
Species Human (GRCh38) Human (GRCh38)
Location Y:23126581-23126603 Y:23126596-23126618
Sequence CCCATCCAGAGCATTAGAATAAG AGAATAAGAGCATCTGAGAATGG
Strand - +
Off-target summary No data {0: 4, 1: 2, 2: 1, 3: 27, 4: 347}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!