ID: 1202280513_1202280518

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1202280513 1202280518
Species Human (GRCh38) Human (GRCh38)
Location Y:23181146-23181168 Y:23181167-23181189
Sequence CCCACATCCCATTGTTCATGATG TGTATGTTAAGGTAAAAATGAGG
Strand - +
Off-target summary {0: 7, 1: 0, 2: 0, 3: 15, 4: 152} {0: 7, 1: 0, 2: 6, 3: 25, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!