ID: 1202379035_1202379047

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1202379035 1202379047
Species Human (GRCh38) Human (GRCh38)
Location Y:24260557-24260579 Y:24260586-24260608
Sequence CCACCCCCATCTGCAGGCCCACA AGGGGAGTAGAAGGAAGAAAGGG
Strand - +
Off-target summary No data {0: 3, 1: 1, 2: 13, 3: 224, 4: 2001}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!