ID: 1202436318_1202436323

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1202436318 1202436323
Species Human (GRCh38) Human (GRCh38)
Location Y:24840892-24840914 Y:24840913-24840935
Sequence CCTCATTTTTACCTTAACATACA CATCATGAACAATGGGATGTGGG
Strand - +
Off-target summary {0: 7, 1: 0, 2: 6, 3: 25, 4: 422} {0: 7, 1: 0, 2: 0, 3: 15, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!