ID: 1202454947_1202454948

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1202454947 1202454948
Species Human (GRCh38) Human (GRCh38)
Location Y:25048602-25048624 Y:25048616-25048638
Sequence CCAAGCACACTATTGCCAGGAAA GCCAGGAAAAAAAGAAAAAGAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 17, 4: 201} {0: 3, 1: 1, 2: 18, 3: 209, 4: 2101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!