ID: 1202491736_1202491744

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1202491736 1202491744
Species Human (GRCh38) Human (GRCh38)
Location Y:25409536-25409558 Y:25409559-25409581
Sequence CCTTTCTTCCTTCTACTCCCCTG AGTCATGTGGGCCTGCAGATGGG
Strand - +
Off-target summary {0: 3, 1: 4, 2: 110, 3: 134, 4: 1470} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!