ID: 1202511028_1202511035

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1202511028 1202511035
Species Human (GRCh38) Human (GRCh38)
Location Y:25574713-25574735 Y:25574757-25574779
Sequence CCAAACCCAGTAACAGGCCAAGA GGTTATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!