ID: 1202511030_1202511033

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1202511030 1202511033
Species Human (GRCh38) Human (GRCh38)
Location Y:25574719-25574741 Y:25574736-25574758
Sequence CCAGTAACAGGCCAAGAGTTGTC GTTGTCTCTCAATAGGACAATGG
Strand - +
Off-target summary {0: 17, 1: 171, 2: 183, 3: 131, 4: 176} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!