ID: 1202814010_1202814024

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1202814010 1202814024
Species Human (GRCh38) Human (GRCh38)
Location 11_KI270721v1_random:39062-39084 11_KI270721v1_random:39092-39114
Sequence CCCAGGGTCCATCTGAGCCCAGG ACACTATCCCCGGGGGTCCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 32, 4: 305} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!