ID: 1202854747_1202854758

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1202854747 1202854758
Species Human (GRCh38) Human (GRCh38)
Location 14_GL000225v1_random:43388-43410 14_GL000225v1_random:43419-43441
Sequence CCTGCGCGCCTGTGGCTCTCCCA TTTCGTGAGGCAAGGAGCGAGGG
Strand - +
Off-target summary {0: 1, 1: 26, 2: 15, 3: 23, 4: 172} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!