ID: 1202854760_1202854768

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1202854760 1202854768
Species Human (GRCh38) Human (GRCh38)
Location 14_GL000225v1_random:43446-43468 14_GL000225v1_random:43462-43484
Sequence CCCCGTGCTCCAGCGCAGCCAGG AGCCAGGCCGGGCTGGCAGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!