ID: 1202857165_1202857171

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1202857165 1202857171
Species Human (GRCh38) Human (GRCh38)
Location 14_GL000225v1_random:58719-58741 14_GL000225v1_random:58745-58767
Sequence CCAAGGAGCGAGGGCCGCCCCTG CAGTCCAACCAGTCTGTGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 13, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!