ID: 1202864261_1202864268

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1202864261 1202864268
Species Human (GRCh38) Human (GRCh38)
Location 14_GL000225v1_random:104909-104931 14_GL000225v1_random:104947-104969
Sequence CCTGGCTGGGCTGGAGCACGGGG TGTCTCACAAAAGCCCCCTGTGG
Strand - +
Off-target summary {0: 9, 1: 10, 2: 35, 3: 72, 4: 786} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!