ID: 1203081504_1203081526

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1203081504 1203081526
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:1148024-1148046 16_KI270728v1_random:1148070-1148092
Sequence CCCGCGCCCCCGGCCCCGGCCGG ACCCGAGACTCCGTTGGCGGCGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 13, 3: 197, 4: 1319} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!