ID: 1203090047_1203090061

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1203090047 1203090061
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:1207829-1207851 16_KI270728v1_random:1207874-1207896
Sequence CCCTGCCCCAGTGAGCCCAGTCT TCATCAGGGCACCCCCCTCTGGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 1, 3: 43, 4: 415} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!