ID: 1203090052_1203090059

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1203090052 1203090059
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:1207836-1207858 16_KI270728v1_random:1207860-1207882
Sequence CCAGTGAGCCCAGTCTGATGGAG AGACACGGGCTCTGTCATCAGGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 4, 3: 14, 4: 190} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!