ID: 1203165180_1203165187

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1203165180 1203165187
Species Human (GRCh38) Human (GRCh38)
Location 17_GL000205v2_random:87192-87214 17_GL000205v2_random:87239-87261
Sequence CCCAGGAAGCAGAAGGAGGGGTC AATGCGCACTGTCCCTGAGCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 37, 4: 348} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!