ID: 1203215959_1203215964

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1203215959 1203215964
Species Human (GRCh38) Human (GRCh38)
Location 22_KI270731v1_random:6000-6022 22_KI270731v1_random:6018-6040
Sequence CCTCCTGACCACCTGGCTCAAAG CAAAGAAAACAGAAGCATGGAGG
Strand - +
Off-target summary No data {0: 10, 1: 0, 2: 6, 3: 100, 4: 772}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!